| p-value: | 1e-5 |
| log p-value: | -1.315e+01 |
| Information Content per bp: | 1.747 |
| Number of Target Sequences with motif | 20.0 |
| Percentage of Target Sequences with motif | 16.67% |
| Number of Background Sequences with motif | 1972.3 |
| Percentage of Background Sequences with motif | 4.96% |
| Average Position of motif in Targets | 42.5 +/- 27.1bp |
| Average Position of motif in Background | 48.8 +/- 43.0bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.20 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-122* MIMAT0004590 Homo sapiens miR-122* Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.68 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATGGCGA- TATTTAGTGTGATAATGGCGTT |
|
|
|
hsa-miR-4304 MIMAT0016854 Homo sapiens miR-4304 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.63 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------ATGGCGA TGCCCTGGACATGCCGG |
|
|
|
hsa-miR-1307 MIMAT0005951 Homo sapiens miR-1307 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.61 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ATGGCGA-- CACGACCGACGCCACGCCGAGT |
|
|
|
hsa-miR-3187-3p MIMAT0015069 Homo sapiens miR-3187-3p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.61 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------ATGGCGA- CCGCGCAGCCCCATGGCCAA |
|
|
|
hsa-miR-4798-5p MIMAT0019974 Homo sapiens miR-4798-5p Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.60 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATGGCGA- CCAATTCACAAAGTATACCGAA |
|
|
|
hsa-miR-1181 MIMAT0005826 Homo sapiens miR-1181 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.60 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------ATGGCGA--- CGGCTCGGGTGGCGGCGACGG |
|
|
|
hsa-miR-4776-3p MIMAT0019933 Homo sapiens miR-4776-3p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.59 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------ATGGCGA- ATGCAGTGGACCAGGATGGCAAG |
|
|
|
hsa-miR-1249 MIMAT0005901 Homo sapiens miR-1249 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.58 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------ATGGCGA TGAAGAAGGGGGGGAAGGGCGT |
|
|
|
hsa-miR-4790-5p MIMAT0019961 Homo sapiens miR-4790-5p Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.57 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------ATGGCGA- AACATGAATGGTAAAGCGAT |
|
|
|
hsa-miR-1234 MIMAT0005589 Homo sapiens miR-1234 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.55 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------ATGGCGA GTGGGGTGGGTGGTCAGGCCGA |
|
|
|