| p-value: | 1e-8 |
| log p-value: | -1.911e+01 |
| Information Content per bp: | 1.959 |
| Number of Target Sequences with motif | 7.0 |
| Percentage of Target Sequences with motif | 5.83% |
| Number of Background Sequences with motif | 77.4 |
| Percentage of Background Sequences with motif | 0.19% |
| Average Position of motif in Targets | 65.1 +/- 17.0bp |
| Average Position of motif in Background | 54.3 +/- 48.6bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-518d-3p MIMAT0002864 Homo sapiens miR-518d-3p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.70 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GCGATTT- GCTCCAAAGGGAAGCGCTTTG |
|
|
|
hsa-miR-518f MIMAT0002842 Homo sapiens miR-518f Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.70 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GCGATTT- CCTCTAAAGAGAAGCGCTTTC |
|
|
|
hsa-miR-518a-3p MIMAT0002863 Homo sapiens miR-518a-3p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.69 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GCGATTT- TCCAGCAAAGGGAAGCGCTTTC |
|
|
|
hsa-miR-518b MIMAT0002844 Homo sapiens miR-518b Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.69 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GCGATTT- ACCTCTAAAGGGGAGCGCTTTG |
|
|
|
hsa-miR-518c MIMAT0002848 Homo sapiens miR-518c Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.68 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GCGATTT- ACACTCTAAAGAGAAGCGCTTTG |
|
|
|
hsa-miR-605 MIMAT0003273 Homo sapiens miR-605 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.68 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GCGATTT- AGGAGAAGGCACCATGGGATTTA |
|
|
|
hsa-miR-548c-3p MIMAT0003285 Homo sapiens miR-548c-3p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.64 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------GCGATTT--- GCAAAAGTAATTGAGATTTTTG |
|
|
|
hsa-miR-518e MIMAT0002861 Homo sapiens miR-518e Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.64 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GCGATTT CACTCTGAAGGGAAGCGCTTT |
|
|
|
hsa-miR-216b MIMAT0004959 Homo sapiens miR-216b Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.63 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GCGATTT TCACATTTGCCTGCAGAGATTT |
|
|
|
hsa-miR-302f MIMAT0005932 Homo sapiens miR-302f Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.61 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------GCGATTT AAACATGGAAGCAATTA |
|
|
|