| p-value: | 1e-8 |
| log p-value: | -1.925e+01 |
| Information Content per bp: | 1.820 |
| Number of Target Sequences with motif | 29.0 |
| Percentage of Target Sequences with motif | 24.17% |
| Number of Background Sequences with motif | 2825.0 |
| Percentage of Background Sequences with motif | 7.10% |
| Average Position of motif in Targets | 47.7 +/- 28.4bp |
| Average Position of motif in Background | 50.2 +/- 38.8bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.10 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4423-3p MIMAT0018936 Homo sapiens miR-4423-3p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.70 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GTGCGTA- TTGTTGCTTTTTGGTGCCTAT |
|
|
|
hsa-miR-521 MIMAT0002854 Homo sapiens miR-521 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.68 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GTGCGTA ACACTCTAAAGGGAAGTGCGTT |
|
|
|
hsa-miR-4788 MIMAT0019958 Homo sapiens miR-4788 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.67 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GTGCGTA- GCCTCCCTTAGCTGGTCCGTAA |
|
|
|
hsa-miR-507 MIMAT0002879 Homo sapiens miR-507 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.64 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GTGCGTA- TTCACTCCAAAAGGTGCAAAA |
|
|
|
hsa-miR-1271 MIMAT0005796 Homo sapiens miR-1271 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.64 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GTGCGTA- TGAGTGCTTGCTAGGTGCCAAG |
|
|
|
hsa-miR-557 MIMAT0003221 Homo sapiens miR-557 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.63 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GTGCGTA- AGACAAGGCCCACCCGTGCAAAC |
|
|
|
hsa-miR-96 MIMAT0000095 Homo sapiens miR-96 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.63 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GTGCGTA- AGCAAAAATGTGCTAGTGCCAAA |
|
|
|
hsa-miR-3941 MIMAT0018357 Homo sapiens miR-3941 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.63 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GTGCGTA- TATGATCCTCAGTTGTGTGTAA |
|
|
|
hsa-miR-106b* MIMAT0004672 Homo sapiens miR-106b* Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.61 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GTGCGTA GCAGCAAGTACCCACAGTGCGG- |
|
|
|
hsa-miR-4503 MIMAT0019039 Homo sapiens miR-4503 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.59 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GTGCGTA-- TAAATTCTATTTCCTGCTTAAA |
|
|
|