| p-value: | 1e-9 |
| log p-value: | -2.166e+01 |
| Information Content per bp: | 1.530 |
| Number of Target Sequences with motif | 9.0 |
| Percentage of Target Sequences with motif | 7.50% |
| Number of Background Sequences with motif | 133.5 |
| Percentage of Background Sequences with motif | 0.34% |
| Average Position of motif in Targets | 43.0 +/- 22.6bp |
| Average Position of motif in Background | 52.9 +/- 34.2bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4295 MIMAT0016844 Homo sapiens miR-4295 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.82 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------ATTGCAC-- AAGGAAAACATTGCACTG |
|
|
|
hsa-miR-130b MIMAT0000691 Homo sapiens miR-130b Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.79 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ATTGCAC-- ATGCCCTTTCATCATTGCACTG |
|
|
|
hsa-miR-130a MIMAT0000425 Homo sapiens miR-130a Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.79 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ATTGCAC-- ATGCCCTTTTAACATTGCACTG |
|
|
|
hsa-miR-301b MIMAT0004958 Homo sapiens miR-301b Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.78 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATTGCAC-- GCTTTGACAATATCATTGCACTG |
|
|
|
hsa-miR-301a MIMAT0000688 Homo sapiens miR-301a Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.78 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATTGCAC-- GCTTTGACAATACTATTGCACTG |
|
|
|
hsa-miR-454 MIMAT0003885 Homo sapiens miR-454 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.78 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATTGCAC-- ACCCTATAAGCAATATTGCACTA |
|
|
|
hsa-miR-3666 MIMAT0018088 Homo sapiens miR-3666 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.73 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------ATTGCAC-- TCGGCATCTACACTTGCACTG |
|
|
|
hsa-miR-106a* MIMAT0004517 Homo sapiens miR-106a* Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.72 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------ATTGCAC GTAAGAAGTGCTTACATTGCAG |
|
|
|
hsa-miR-143* MIMAT0004599 Homo sapiens miR-143* Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.70 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATTGCAC- ACCAGAGATGCAGCACTGCACC |
|
|
|
hsa-miR-19a MIMAT0000073 Homo sapiens miR-19a Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.69 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------ATTGCAC- TCAGTTTTGCATAGATTTGCACA |
|
|
|