| p-value: | 1e-6 |
| log p-value: | -1.505e+01 |
| Information Content per bp: | 1.849 |
| Number of Target Sequences with motif | 23.0 |
| Percentage of Target Sequences with motif | 19.17% |
| Number of Background Sequences with motif | 2261.7 |
| Percentage of Background Sequences with motif | 5.70% |
| Average Position of motif in Targets | 55.4 +/- 26.4bp |
| Average Position of motif in Background | 48.8 +/- 41.3bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.17 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4690-5p MIMAT0019779 Homo sapiens miR-4690-5p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.71 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------CGACTGC-- TTCAGCCCAGCCTCGCCTGCTC |
|
|
|
hsa-miR-4274 MIMAT0016906 Homo sapiens miR-4274 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.69 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------CGACTGC-- CAGGGGGAGGGACTGCTG |
|
|
|
hsa-miR-3937 MIMAT0018352 Homo sapiens miR-3937 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.66 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------CGACTGC CCCCCATTGCTACAGCCGCCTGT |
|
|
|
hsa-miR-3665 MIMAT0018087 Homo sapiens miR-3665 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.64 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------CGACTGC- CGCCGCCCCGCACCTGCT |
|
|
|
hsa-miR-1909 MIMAT0007883 Homo sapiens miR-1909 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.64 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CGACTGC- CGGTGAGCACCCGGCCCCTGCG |
|
|
|
hsa-miR-4722-5p MIMAT0019836 Homo sapiens miR-4722-5p Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.62 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CGACTGC- CAACCTGGCACAGCCCTCCTGCC |
|
|
|
hsa-miR-3186-5p MIMAT0015067 Homo sapiens miR-3186-5p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.61 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------CGACTGC AAGCCACGTAGACAGACGCCTG- |
|
|
|
hsa-miR-4767 MIMAT0019919 Homo sapiens miR-4767 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.60 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CGACTGC- GGCGGCGGCCAGGAGCGCCCGCG |
|
|
|
hsa-miR-509-3-5p MIMAT0004975 Homo sapiens miR-509-3-5p Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.60 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------CGACTGC---- CATGATTGCCACGTCTGCAGTA |
|
|
|
hsa-miR-3129-5p MIMAT0014992 Homo sapiens miR-3129-5p Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.59 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CGACTGC AAACCAATCTCTACACTACTGC |
|
|
|