| p-value: | 1e-6 |
| log p-value: | -1.593e+01 |
| Information Content per bp: | 1.792 |
| Number of Target Sequences with motif | 13.0 |
| Percentage of Target Sequences with motif | 10.83% |
| Number of Background Sequences with motif | 658.0 |
| Percentage of Background Sequences with motif | 1.66% |
| Average Position of motif in Targets | 32.6 +/- 28.4bp |
| Average Position of motif in Background | 49.5 +/- 48.3bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-638 MIMAT0003308 Homo sapiens miR-638 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.65 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GCGATGC-- AGGCCGCCACCCGCCCGCGATCCCT |
|
|
|
hsa-miR-153 MIMAT0000439 Homo sapiens miR-153 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.63 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GCGATGC-- GATCACTTTTGTGACTATGCAA |
|
|
|
hsa-miR-324-5p MIMAT0000761 Homo sapiens miR-324-5p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.63 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GCGATGC- ACACCAATGCCCTAGGGGATGCG |
|
|
|
hsa-miR-33b MIMAT0003301 Homo sapiens miR-33b Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.63 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------GCGATGC-- GCAATGCAACAGCAATGCAC |
|
|
|
hsa-miR-4642 MIMAT0019702 Homo sapiens miR-4642 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.62 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------GCGATGC--- AGCCACCAGGGGACGATGCCAT |
|
|
|
hsa-miR-103b MIMAT0007402 Homo sapiens miR-103b Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.59 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GCGATGC AGCAGCATTGTACAGGGCTATGA |
|
|
|
hsa-miR-33a MIMAT0000091 Homo sapiens miR-33a Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.57 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------GCGATGC-- TGCAATGCAACTACAATGCAC |
|
|
|
hsa-miR-3622b-5p MIMAT0018005 Homo sapiens miR-3622b-5p Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.56 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------GCGATGC-- TCACCTGACCTCCCATGCCT |
|
|
|
hsa-miR-2964a-3p MIMAT0019748 Homo sapiens miR-2964a-3p Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.56 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GCGATGC- ACTGATTGTCCAAACGCAATTCT |
|
|
|
hsa-miR-3651 MIMAT0018071 Homo sapiens miR-3651 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.56 |
| Offset: | -18 |
| Orientation: | forward strand |
| Alignment: | ------------------GCGATGC TCATGTACCAGCGACCGGGCTATG- |
|
|
|