| p-value: | 1e-8 |
| log p-value: | -1.941e+01 |
| Information Content per bp: | 1.935 |
| Number of Target Sequences with motif | 15.0 |
| Percentage of Target Sequences with motif | 12.50% |
| Number of Background Sequences with motif | 694.6 |
| Percentage of Background Sequences with motif | 1.75% |
| Average Position of motif in Targets | 52.4 +/- 28.4bp |
| Average Position of motif in Background | 50.7 +/- 39.3bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-3065-3p MIMAT0015378 Homo sapiens miR-3065-3p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.77 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GTGCTGA CTCCAACAATATCCTGGTGCTGA |
|
|
|
hsa-miR-4291 MIMAT0016922 Homo sapiens miR-4291 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.72 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------GTGCTGA- AGCTGTTCCTGCTGAA |
|
|
|
hsa-miR-197 MIMAT0000227 Homo sapiens miR-197 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.68 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GTGCTGA- GCTGGGTGGAGAAGGTGGTGAA |
|
|
|
hsa-miR-34a* MIMAT0004557 Homo sapiens miR-34a* Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.63 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------GTGCTGA--- AGGGCAGTATACTTGCTGATTG |
|
|
|
hsa-miR-3663-3p MIMAT0018085 Homo sapiens miR-3663-3p Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.63 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GTGCTGA GCGCCCGGCCTGTGTGGTGCTCA |
|
|
|
hsa-miR-29c MIMAT0000681 Homo sapiens miR-29c Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.62 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GTGCTGA TAACCGATTTCAAATGGTGCTA- |
|
|
|
hsa-miR-29a MIMAT0000086 Homo sapiens miR-29a Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.62 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GTGCTGA TAACCGATTTCAGATGGTGCTA- |
|
|
|
hsa-miR-29b MIMAT0000100 Homo sapiens miR-29b Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.62 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------GTGCTGA AACACTGATTTCAAATGGTGCTA- |
|
|
|
hsa-miR-4793-3p MIMAT0019966 Homo sapiens miR-4793-3p Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.62 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GTGCTGA AGCCAGCCAACTCACAGTGCAGA |
|
|
|
hsa-miR-195 MIMAT0000461 Homo sapiens miR-195 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.61 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------GTGCTGA-- GCCAATATTTCTGTGCTGCTA |
|
|
|