| p-value: | 1e-6 |
| log p-value: | -1.480e+01 |
| Information Content per bp: | 1.739 |
| Number of Target Sequences with motif | 16.0 |
| Percentage of Target Sequences with motif | 13.33% |
| Number of Background Sequences with motif | 1138.5 |
| Percentage of Background Sequences with motif | 2.86% |
| Average Position of motif in Targets | 52.5 +/- 23.9bp |
| Average Position of motif in Background | 51.2 +/- 33.0bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4792 MIMAT0019964 Homo sapiens miR-4792 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.67 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------GGCTHAY-- GCCAGCGAGCGCTCACCG |
|
|
|
hsa-miR-556-5p MIMAT0003220 Homo sapiens miR-556-5p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.57 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GGCTHAY- CTCATATTACAATGAGCTCATC |
|
|
|
hsa-miR-4316 MIMAT0016867 Homo sapiens miR-4316 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.57 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------GGCTHAY- CACCAGCTAGCCTCACC |
|
|
|
hsa-miR-4662a-5p MIMAT0019731 Homo sapiens miR-4662a-5p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.57 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GGCTHAY CTAAAGATGGACAATTGGCTAA- |
|
|
|
hsa-miR-640 MIMAT0003310 Homo sapiens miR-640 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.57 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GGCTHAY AGAGGCAGGTTCCTGGATCAT |
|
|
|
hsa-miR-1233 MIMAT0005588 Homo sapiens miR-1233 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.57 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GGCTHAY CTGCGGGAGGACAGGGCTCA- |
|
|
|
hsa-miR-3157-5p MIMAT0015031 Homo sapiens miR-3157-5p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.56 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GGCTHAY AGACTGCACTAGCCTGGCTGAA |
|
|
|
hsa-miR-1225-3p MIMAT0005573 Homo sapiens miR-1225-3p Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.56 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GGCTHAY CTGGGGGCGGCACAGGGGCTCA- |
|
|
|
hsa-miR-4537 MIMAT0019080 Homo sapiens miR-4537 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.56 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GGCTHAY CAGCTAAGCTCAGCTCGGCTCA- |
|
|
|
hsa-miR-3672 MIMAT0018095 Homo sapiens miR-3672 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.56 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GGCTHAY AAGATGTTTTACATGAGTCTCAT |
|
|
|