| p-value: | 1e-4 |
| log p-value: | -1.043e+01 |
| Information Content per bp: | 1.872 |
| Number of Target Sequences with motif | 57.0 |
| Percentage of Target Sequences with motif | 47.50% |
| Number of Background Sequences with motif | 11799.1 |
| Percentage of Background Sequences with motif | 29.67% |
| Average Position of motif in Targets | 49.8 +/- 28.4bp |
| Average Position of motif in Background | 50.5 +/- 35.4bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.14 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4755-5p MIMAT0019895 Homo sapiens miR-4755-5p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.70 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GGGAA- AAAGCCAGGCTCTGAAGGGAAA |
|
|
|
hsa-miR-3679-3p MIMAT0018105 Homo sapiens miR-3679-3p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.70 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GGGAA- GATGAAGATTACTGGGGGGAAG |
|
|
|
hsa-miR-3938 MIMAT0018353 Homo sapiens miR-3938 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.70 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GGGAA-- CCGGGTTATCTACAAGGGAATT |
|
|
|
hsa-miR-4446-5p MIMAT0019233 Homo sapiens miR-4446-5p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.70 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GGGAA-- GCCAAGGGAATGGCAGGGAAAT |
|
|
|
hsa-miR-3124-3p MIMAT0019200 Homo sapiens miR-3124-3p Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.63 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GGGAA-- ACTTCACGGGAGTGAGGAAAGT |
|
|
|
hsa-miR-617 MIMAT0003286 Homo sapiens miR-617 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.60 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GGGAA---- GCCACCTTCAAATGGGAAGTCT |
|
|
|
hsa-miR-1236 MIMAT0005591 Homo sapiens miR-1236 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.60 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GGGAA---- CTGGAGAGACAAGGGGAAGAGG |
|
|
|
hsa-miR-211 MIMAT0000268 Homo sapiens miR-211 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.60 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------GGGAA AGGCGAAGGATGACAAAGGGAA |
|
|
|
hsa-miR-204 MIMAT0000265 Homo sapiens miR-204 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.60 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------GGGAA AGGCATAGGATGACAAAGGGAA |
|
|
|
hsa-miR-2355-5p MIMAT0016895 Homo sapiens miR-2355-5p Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.58 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GGGAA- TTGTCCATTGTATCTGGGGAT |
|
|
|