| p-value: | 1e-5 |
| log p-value: | -1.214e+01 |
| Information Content per bp: | 1.867 |
| Number of Target Sequences with motif | 25.0 |
| Percentage of Target Sequences with motif | 20.83% |
| Number of Background Sequences with motif | 3102.4 |
| Percentage of Background Sequences with motif | 7.80% |
| Average Position of motif in Targets | 56.8 +/- 27.1bp |
| Average Position of motif in Background | 51.7 +/- 33.8bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-591 MIMAT0003259 Homo sapiens miR-591 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.80 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------CATGGT-- ACAATGAGAACCCATGGTCT |
|
|
|
hsa-miR-767-5p MIMAT0003882 Homo sapiens miR-767-5p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.72 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CATGGT--- CATGCTCAGACAACCATGGTGCA |
|
|
|
hsa-miR-3619-3p MIMAT0019219 Homo sapiens miR-3619-3p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.67 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------CATGGT--- CCACAGCAGGCAGGATGGTCCC |
|
|
|
hsa-miR-181c* MIMAT0004559 Homo sapiens miR-181c* Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.64 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CATGGT- GTCCACTCAACGGTCGATGGTT |
|
|
|
hsa-miR-1911* MIMAT0007886 Homo sapiens miR-1911* Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.63 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------CATGGT- GGAGACCACAATGCCTGGTG |
|
|
|
hsa-miR-4733-3p MIMAT0019858 Homo sapiens miR-4733-3p Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.62 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CATGGT-- ATCCCAATGCTAGACCTGGTGG |
|
|
|
hsa-miR-4716-5p MIMAT0019826 Homo sapiens miR-4716-5p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.62 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------CATGGT AGAAGGGGGAAGGAAACATGGA |
|
|
|
hsa-miR-3591-3p MIMAT0019877 Homo sapiens miR-3591-3p Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.61 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------CATGGT---- GTGGAGTGTGACAATGGTGTTT |
|
|
|
hsa-miR-29c MIMAT0000681 Homo sapiens miR-29c Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.61 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------CATGGT---- TAACCGATTTCAAATGGTGCTA |
|
|
|
hsa-miR-29b MIMAT0000100 Homo sapiens miR-29b Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.61 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------CATGGT---- AACACTGATTTCAAATGGTGCTA |
|
|
|