| p-value: | 1e-10 |
| log p-value: | -2.524e+01 |
| Information Content per bp: | 1.794 |
| Number of Target Sequences with motif | 16.0 |
| Percentage of Target Sequences with motif | 13.33% |
| Number of Background Sequences with motif | 540.8 |
| Percentage of Background Sequences with motif | 1.36% |
| Average Position of motif in Targets | 50.4 +/- 28.3bp |
| Average Position of motif in Background | 52.1 +/- 41.4bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-645 MIMAT0003315 Homo sapiens miR-645 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.62 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------ATCGTAG- TCAGCAGTACCAGCCTAGA |
|
|
|
hsa-miR-651 MIMAT0003321 Homo sapiens miR-651 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.59 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATCGTAG- CAAAAGTCAAGCTTATCCTAAA |
|
|
|
hsa-miR-4679 MIMAT0019763 Homo sapiens miR-4679 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.57 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATCGTAG- AGCAAAGAATCTCTATCACAGA |
|
|
|
hsa-miR-4266 MIMAT0016892 Homo sapiens miR-4266 Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.56 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------ATCGTAG GGCCAAGGCCTCCTAG |
|
|
|
hsa-miR-4330 MIMAT0016924 Homo sapiens miR-4330 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.56 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------ATCGTAG- GCAAGGCTCTGATCTGAGG |
|
|
|
hsa-miR-3135 MIMAT0015001 Homo sapiens miR-3135 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.56 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------ATCGTAG--- CACTGCAGTCTCAGCCTAGGCA |
|
|
|
hsa-miR-191* MIMAT0001618 Homo sapiens miR-191* Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.56 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATCGTAG- GGGGACGAAATCCAAGCGCAGC |
|
|
|
hsa-miR-2392 MIMAT0019043 Homo sapiens miR-2392 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.55 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATCGTAG CACCTCTCACCCCCATCCTA- |
|
|
|
hsa-let-7d* MIMAT0004484 Homo sapiens let-7d* Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.54 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ATCGTAG-- AGAAAGGCAGCAGGTCGTATAG |
|
|
|
hsa-miR-187* MIMAT0004561 Homo sapiens miR-187* Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.54 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ATCGTAG-- GCCCGGGTCCTGTGTTGTAGCC |
|
|
|