| p-value: | 1e-4 |
| log p-value: | -1.132e+01 |
| Information Content per bp: | 1.878 |
| Number of Target Sequences with motif | 37.0 |
| Percentage of Target Sequences with motif | 30.83% |
| Number of Background Sequences with motif | 6027.3 |
| Percentage of Background Sequences with motif | 15.20% |
| Average Position of motif in Targets | 48.1 +/- 25.7bp |
| Average Position of motif in Background | 50.6 +/- 38.7bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.23 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-549 MIMAT0003333 Homo sapiens miR-549 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.71 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GTTGT-- AGAGCTCATCCATAGTTGTCA |
|
|
|
hsa-miR-4709-5p MIMAT0019811 Homo sapiens miR-4709-5p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.65 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------GTTGT TTGGAGAGCAAGTCACTGTTGT |
|
|
|
hsa-miR-4772-3p MIMAT0019927 Homo sapiens miR-4772-3p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.63 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------GTTGT--- TCTGATCAGGCAAAGTTGCAGG |
|
|
|
hsa-miR-196a* MIMAT0004562 Homo sapiens miR-196a* Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.63 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------GTTGT-- CTCAGGCAGTTTCTTGTTGCCG |
|
|
|
hsa-miR-891b MIMAT0004913 Homo sapiens miR-891b Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.63 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GTTGT- TCAATGACTCAGGTAAGTTGCA |
|
|
|
hsa-miR-891a MIMAT0004902 Homo sapiens miR-891a Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.63 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------GTTGT- TCAGTGGCTCAGGTTCGTTGCA |
|
|
|
hsa-let-7b* MIMAT0004482 Homo sapiens let-7b* Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.60 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GTTGT---- GGGAAGGCAGTAGGTTGTATAG |
|
|
|
hsa-miR-187* MIMAT0004561 Homo sapiens miR-187* Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.60 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------GTTGT---- GCCCGGGTCCTGTGTTGTAGCC |
|
|
|
hsa-miR-4714-3p MIMAT0019823 Homo sapiens miR-4714-3p Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.59 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------GTTGT CAACTCTGACCACCTAGGTTGG |
|
|
|
hsa-miR-3065-5p MIMAT0015066 Homo sapiens miR-3065-5p Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.58 |
| Offset: | -18 |
| Orientation: | forward strand |
| Alignment: | ------------------GTTGT TCCAGCATCAGTGATTTTGTTGA |
|
|
|