| p-value: | 1e-8 |
| log p-value: | -1.882e+01 |
| Information Content per bp: | 1.530 |
| Number of Target Sequences with motif | 11.0 |
| Percentage of Target Sequences with motif | 9.17% |
| Number of Background Sequences with motif | 330.7 |
| Percentage of Background Sequences with motif | 0.83% |
| Average Position of motif in Targets | 52.2 +/- 21.0bp |
| Average Position of motif in Background | 48.2 +/- 34.8bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-106a* MIMAT0004517 Homo sapiens miR-106a* Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.72 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------CCATTGC-- GTAAGAAGTGCTTACATTGCAG |
|
|
|
hsa-miR-3908 MIMAT0018182 Homo sapiens miR-3908 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.72 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------CCATTGC-- AAACAGTCTACCTACATTGCTC |
|
|
|
hsa-miR-4766-3p MIMAT0019918 Homo sapiens miR-4766-3p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.65 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------CCATTGC--- TTCCAAAAGAGCAATTGCTAT |
|
|
|
hsa-miR-518a-5p MIMAT0005457 Homo sapiens miR-518a-5p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.64 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------CCATTGC-- GAAAGGGCTTCCCTTTGCAG |
|
|
|
hsa-miR-527 MIMAT0002862 Homo sapiens miR-527 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.64 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------CCATTGC-- GAAAGGGCTTCCCTTTGCAG |
|
|
|
hsa-miR-182 MIMAT0000259 Homo sapiens miR-182 Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.63 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------CCATTGC---- AGTGTGAGTTCTACCATTGCCAAA |
|
|
|
hsa-miR-4506 MIMAT0019042 Homo sapiens miR-4506 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.61 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CCATTGC TTGCCTCAGACCACCCATTT- |
|
|
|
hsa-miR-4295 MIMAT0016844 Homo sapiens miR-4295 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.60 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------CCATTGC---- AAGGAAAACATTGCACTG |
|
|
|
hsa-miR-4519 MIMAT0019056 Homo sapiens miR-4519 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.58 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------CCATTGC-- CAGCCCTGCGCACTGCTG |
|
|
|
hsa-miR-548al MIMAT0019024 Homo sapiens miR-548al Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.58 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------CCATTGC---- TGGTACAAAAGTCATTGCCGTT |
|
|
|