| p-value: | 1e-8 |
| log p-value: | -2.041e+01 |
| Information Content per bp: | 1.743 |
| Number of Target Sequences with motif | 46.0 |
| Percentage of Target Sequences with motif | 38.33% |
| Number of Background Sequences with motif | 6183.3 |
| Percentage of Background Sequences with motif | 15.59% |
| Average Position of motif in Targets | 56.8 +/- 29.6bp |
| Average Position of motif in Background | 50.5 +/- 36.5bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.22 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4330 MIMAT0016924 Homo sapiens miR-4330 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.72 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------ATCCGA-- GCAAGGCTCTGATCTGAGG |
|
|
|
hsa-miR-3942-3p MIMAT0019230 Homo sapiens miR-3942-3p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.70 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ATCCGA-- ATGTAATACTGTTATCTGAAA |
|
|
|
hsa-miR-127-3p MIMAT0000446 Homo sapiens miR-127-3p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.70 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------ATCCGA AGCCAAGCTCAGACGGATCCGA |
|
|
|
hsa-miR-4762-3p MIMAT0019911 Homo sapiens miR-4762-3p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.68 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATCCGA-- CACCACAAATCTTGATCAGAAG |
|
|
|
hsa-miR-3610 MIMAT0017987 Homo sapiens miR-3610 Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.64 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------ATCCGA--- CGGCGCCTCCTTTCCGATTC |
|
|
|
hsa-miR-105* MIMAT0004516 Homo sapiens miR-105* Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.62 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------ATCCGA TAGCACATGCTCAAACATCCGT |
|
|
|
hsa-miR-1245b-3p MIMAT0019951 Homo sapiens miR-1245b-3p Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.62 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------ATCCGA TATAGGCCTTTAGATCATCTGA |
|
|
|
hsa-miR-651 MIMAT0003321 Homo sapiens miR-651 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.61 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATCCGA-- CAAAAGTCAAGCTTATCCTAAA |
|
|
|
hsa-miR-3917 MIMAT0018191 Homo sapiens miR-3917 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.60 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------ATCCGA-- CCCACCTGCTCAGTCCGAGC |
|
|
|
hsa-miR-4654 MIMAT0019720 Homo sapiens miR-4654 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.59 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------ATCCGA-- CCAGATGCCTCCAGATCCCACA |
|
|
|