| p-value: | 1e-9 |
| log p-value: | -2.160e+01 |
| Information Content per bp: | 1.809 |
| Number of Target Sequences with motif | 21.0 |
| Percentage of Target Sequences with motif | 17.50% |
| Number of Background Sequences with motif | 1301.7 |
| Percentage of Background Sequences with motif | 3.28% |
| Average Position of motif in Targets | 52.2 +/- 29.5bp |
| Average Position of motif in Background | 49.0 +/- 40.7bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.19 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-4798-3p MIMAT0019975 Homo sapiens miR-4798-3p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.63 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------TTCGGGA--- ACTTCGGTATACTTCGTGAGTT |
|
|
|
hsa-miR-4671-5p MIMAT0019752 Homo sapiens miR-4671-5p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.58 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------TTCGGGA AGATTAGCGCACAGTCTTCGGT- |
|
|
|
hsa-miR-4281 MIMAT0016907 Homo sapiens miR-4281 Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.57 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------TTCGGGA--- CCCCCCTCCCCGGGACCC |
|
|
|
hsa-miR-519e* MIMAT0002828 Homo sapiens miR-519e* Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.55 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TTCGGGA- GAAAGTGCTCCCTTTTGGAGAA |
|
|
|
hsa-miR-188-3p MIMAT0004613 Homo sapiens miR-188-3p Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.55 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TTCGGGA- TGCAAACCCTGCATGTGGGAG |
|
|
|
hsa-miR-515-5p MIMAT0002826 Homo sapiens miR-515-5p Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.54 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------TTCGGGA- CAGAAAGTGCTTTCTTTTGGAGAA |
|
|
|
hsa-miR-4449 MIMAT0018968 Homo sapiens miR-4449 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.52 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TTCGGGA-- TGCCTCGCGCAGCCCCGGGACG |
|
|
|
hsa-miR-4719 MIMAT0019832 Homo sapiens miR-4719 Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.52 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------TTCGGGA CCTGCATATTATAGATTTGTGA |
|
|
|
hsa-miR-516a-5p MIMAT0004770 Homo sapiens miR-516a-5p Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.52 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------TTCGGGA- GAAAGTGCTTCTTTCCTCGAGAA |
|
|
|
hsa-miR-34c-3p MIMAT0004677 Homo sapiens miR-34c-3p Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.52 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TTCGGGA-- CCTGGCCGTGTGGTTAGTGATT |
|
|
|