| p-value: | 1e-3 |
| log p-value: | -6.936e+00 |
| Information Content per bp: | 1.530 |
| Number of Target Sequences with motif | 17.0 |
| Percentage of Target Sequences with motif | 14.17% |
| Number of Background Sequences with motif | 2410.0 |
| Percentage of Background Sequences with motif | 6.08% |
| Average Position of motif in Targets | 53.9 +/- 28.8bp |
| Average Position of motif in Background | 49.7 +/- 32.1bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-3117-5p MIMAT0019197 Homo sapiens miR-3117-5p Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.74 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------TAGTG--- ATATGACTCGTATAGTGTCT |
|
|
|
hsa-miR-4301 MIMAT0016850 Homo sapiens miR-4301 Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.74 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------TAGTG--- TCACAAGTGAAGTAGTGGGA |
|
|
|
hsa-miR-4704-5p MIMAT0019803 Homo sapiens miR-4704-5p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.73 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------TAGTG-- AATCACTCACATGCCTAGTGTC |
|
|
|
hsa-miR-34c-3p MIMAT0004677 Homo sapiens miR-34c-3p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.73 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------TAGTG--- CCTGGCCGTGTGGTTAGTGATT |
|
|
|
hsa-miR-34b MIMAT0004676 Homo sapiens miR-34b Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.64 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TAGTG---- ATGGCAGTGGAGTTAGTGATTG |
|
|
|
hsa-miR-28-3p MIMAT0004502 Homo sapiens miR-28-3p Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.64 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------TAGTG TCCAGGAGCTCACAATCTAGTG |
|
|
|
hsa-miR-4286 MIMAT0016916 Homo sapiens miR-4286 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.59 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------TAGTG---- GGTACCAGGAGTGGGGT |
|
|
|
hsa-miR-3156-3p MIMAT0019209 Homo sapiens miR-3156-3p Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.57 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------TAGTG---- AGAAAGATCTGGAAGTGGGAG |
|
|
|
hsa-miR-603 MIMAT0003271 Homo sapiens miR-603 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.56 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TAGTG---- GCAAAAGTAATTGCAGTGTGTG |
|
|
|
hsa-miR-3680 MIMAT0018106 Homo sapiens miR-3680 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.56 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------TAGTG---- TGCACAATCCTGTGAGTGAGTC |
|
|
|