| p-value: | 1e-4 |
| log p-value: | -1.045e+01 |
| Information Content per bp: | 1.530 |
| Number of Target Sequences with motif | 7.0 |
| Percentage of Target Sequences with motif | 5.83% |
| Number of Background Sequences with motif | 285.6 |
| Percentage of Background Sequences with motif | 0.72% |
| Average Position of motif in Targets | 62.1 +/- 22.1bp |
| Average Position of motif in Background | 49.1 +/- 40.1bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-3610 MIMAT0017987 Homo sapiens miR-3610 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.66 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CGATTT CGGCGCCTCCTTTCCGATTC |
|
|
|
hsa-miR-548c-3p MIMAT0003285 Homo sapiens miR-548c-3p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.65 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------CGATTT--- GCAAAAGTAATTGAGATTTTTG |
|
|
|
hsa-miR-4762-5p MIMAT0019910 Homo sapiens miR-4762-5p Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.63 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------CGATTT-- AGGCTTCTGATCAAGATTTGG |
|
|
|
hsa-miR-518d-3p MIMAT0002864 Homo sapiens miR-518d-3p Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.63 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CGATTT- GCTCCAAAGGGAAGCGCTTTG |
|
|
|
hsa-miR-518f MIMAT0002842 Homo sapiens miR-518f Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.63 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CGATTT- CCTCTAAAGAGAAGCGCTTTC |
|
|
|
hsa-miR-4694-3p MIMAT0019787 Homo sapiens miR-4694-3p Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.63 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CGATTT- AGGTGTTATCCTGTCCATTTG |
|
|
|
hsa-miR-424* MIMAT0004749 Homo sapiens miR-424* Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.63 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CGATTT- ATAGCAGCGCCTCACGTTTTG |
|
|
|
hsa-miR-10a* MIMAT0004555 Homo sapiens miR-10a* Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.62 |
| Offset: | -14 |
| Orientation: | forward strand |
| Alignment: | --------------CGATTT-- TATTCCCCTAGATACGAATTTG |
|
|
|
hsa-miR-551b* MIMAT0004794 Homo sapiens miR-551b* Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.62 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CGATTT- GGTCTCACCCACGCTTGATTTC |
|
|
|
hsa-miR-548ad MIMAT0018946 Homo sapiens miR-548ad Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.62 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------CGATTT- TGCAAAAGTCATTGTCGTTTTC |
|
|
|