| p-value: | 1e-4 |
| log p-value: | -1.124e+01 |
| Information Content per bp: | 1.927 |
| Number of Target Sequences with motif | 16.0 |
| Percentage of Target Sequences with motif | 13.33% |
| Number of Background Sequences with motif | 1502.6 |
| Percentage of Background Sequences with motif | 3.79% |
| Average Position of motif in Targets | 49.1 +/- 28.5bp |
| Average Position of motif in Background | 52.1 +/- 37.6bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
hsa-miR-493 MIMAT0003161 Homo sapiens miR-493 Targets (miRBase)
| Match Rank: | 1 |
| Score: | 0.80 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------ACCTTC- CCTGGCACACAGTAGACCTTCA |
|
|
|
hsa-miR-4735-3p MIMAT0019861 Homo sapiens miR-4735-3p Targets (miRBase)
| Match Rank: | 2 |
| Score: | 0.65 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------ACCTTC ATGTCTAATTTGAGCACCTTT |
|
|
|
hsa-miR-548ag MIMAT0018969 Homo sapiens miR-548ag Targets (miRBase)
| Match Rank: | 3 |
| Score: | 0.65 |
| Offset: | -15 |
| Orientation: | forward strand |
| Alignment: | ---------------ACCTTC GCAGAAACCACAATTACCTTT |
|
|
|
hsa-miR-548ai MIMAT0018989 Homo sapiens miR-548ai Targets (miRBase)
| Match Rank: | 4 |
| Score: | 0.65 |
| Offset: | -16 |
| Orientation: | forward strand |
| Alignment: | ----------------ACCTTC GGGAAAAACTGCAATTACCTTT |
|
|
|
hsa-miR-18a MIMAT0000072 Homo sapiens miR-18a Targets (miRBase)
| Match Rank: | 5 |
| Score: | 0.65 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------ACCTTC CTATCTGCACTAGATGCACCTTA |
|
|
|
hsa-miR-18b MIMAT0001412 Homo sapiens miR-18b Targets (miRBase)
| Match Rank: | 6 |
| Score: | 0.65 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------ACCTTC CTAACTGCACTAGATGCACCTTA |
|
|
|
hsa-miR-3974 MIMAT0019359 Homo sapiens miR-3974 Targets (miRBase)
| Match Rank: | 7 |
| Score: | 0.64 |
| Offset: | -17 |
| Orientation: | forward strand |
| Alignment: | -----------------ACCTTC GCATTAACCTTACAATGACCTTT |
|
|
|
hsa-miR-4747-5p MIMAT0019882 Homo sapiens miR-4747-5p Targets (miRBase)
| Match Rank: | 8 |
| Score: | 0.64 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ACCTTC--- CTAAGACCAAGCCTCCTTCCCT |
|
|
|
hsa-miR-4476 MIMAT0019003 Homo sapiens miR-4476 Targets (miRBase)
| Match Rank: | 9 |
| Score: | 0.64 |
| Offset: | -13 |
| Orientation: | forward strand |
| Alignment: | -------------ACCTTC--- GCCTGTCCCTAAATCCTTCCTG |
|
|
|
hsa-miR-3665 MIMAT0018087 Homo sapiens miR-3665 Targets (miRBase)
| Match Rank: | 10 |
| Score: | 0.63 |
| Offset: | -11 |
| Orientation: | forward strand |
| Alignment: | -----------ACCTTC- CGCCGCCCCGCACCTGCT |
|
|
|